You are viewing the site in preview mode

Skip to main content

Cervical lymph node metastases from thyroid cancer: does thyroglobulin and calcitonin measurement in fine needle aspirates improve the diagnostic value of cytology?

Abstract

Background

Measurement of thyroglobulin (Tg) protein in the washout of the needle used for fine needle aspiration biopsy cytology (FNAB-C) has been shown to increase the sensitivity of FNAB-C in identifying cervical lymph node (CLN) metastasis from well-differentiated thyroid cancer (TC). In this study, we evaluated whether routine measurement of Tg protein (FNAB-Tgp), Tg mRNA (FNAB-Tgm) and calcitonin (CT) mRNA (FNAB-CTm) in the FNAB washout of CLN increases the accuracy of FNAB-C in the diagnosis of suspicious metastatic CLN.

Methods

In this prospective study 35 CLN from 28 patients were examined. Histology showed metastatic papillary TC (PTC) in 26 CLN, metastatic medullary TC (MTC) in 3 CLN, metastatic anaplastic TC (ATC) in 3 CLN and 3 metastatic CLN from extra-thyroidal cancers.

Results

The overall accuracy of FNAB-C was 84.4%, reaching 95.7% when the analysis was restricted to PTC. Both FNAB-Tgp and FNAB-Tgm compared favorably with FNAB-C and shown diagnostic performances not statistically different from that of FNAB-C. However, FNAB-Tgp and FNAB-Tgm/FNAB-CTm were found useful in cases in which cytology results were inadequate or provided diagnosis inconsistent with patient's clinical parameters.

Conclusions

We demonstrated that FNAB-C, Tg/CT mRNA and Tg protein determination in the fine-needle washout showed similar accuracy in the diagnosis of metastatic CLN from TC. The results of this study suggest that samples for Tg protein and Tg/CT mRNA measurements from CLN suspicious for metastatic TC should be collected, but their measurements should be restricted to cases in which FNAB-C provides uninformative or inconsistent diagnosis with respect to patient's clinical parameters.

Peer Review reports

Background

Thyroid cancer represents the most frequent endocrine neoplasia, accounting for 1.7% (0.7% in male and 2.7% in female) of all new malignant diseases and 0.5% (0.3% in male and 0.7% in female) of deaths related to cancer worldwide [1, 2]. Thyroid carcinomas originate mostly from the epithelial follicular cells and are represented for 95% by the differentiated (DTC) papillary (PTC) and follicular (FTC) carcinomas, while 1-2% of them are the undifferentiated and unvaryingly fatal anaplastic carcinomas (ATC) [3]. The remaining 3-4% are medullary thyroid carcinomas (MTC) derived from the parafollicular C cells [4]. The accurate diagnosis of locoregional lymph node metastasis is of primary importance for the initial surgical approach as well as for prognostic stratification and follow-up [49]. In this context, fine-needle aspiration biopsy cytology (FNAB-C) represents the gold standard technique for the detection of cervical lymph node (CLN) metastasis [49]. The latter, however, relies on the experience and ability of the cytopathologist, and may be a challenging diagnostic category as CLN could harbor metastasis from a multiplicity of extrathyroidal malignancies or be affected by several non-tumoral diseases [911]. In addition, inadequate cellularity or nonrepresentative sampling, often associated with cystic lymph nodes, prevents diagnosis in about 20% of specimens [1214]. Over the last two decades, a number of studies have demonstrated that measurement of thyroglobulin protein (Tgp) in the washout of the needle used for FNAB (FNAB-Tgp) increases the sensitivity of FNAB-C in identifying CLN metastasis from DTC [1427]. As a consequence, routine association of FNAB-Tgp with FNAB-C in the diagnosis of CLN metastasis from papillary and follicular thyroid cancers has been recommended [6, 7, 15]. Similarly, it has been shown that lymph node detection of Tg mRNA (Tgm) in fine-needle washout implemented the FNAB-C sensitivity for the diagnosis of metastatic CLN from DTC, even if this still needs to be validated on larger case-studies [28].

In the present work we evaluated, in 35 consecutive CLN for which the histological diagnosis was available, if routine measurement of thyroglobulin (Tg) protein and Tg and calcitonin (CT) mRNA in the washout of the needle used for FNAB increases the sensitivity of FNAB-C in identifying cervical lymph node (CLN) metastasis from either DTC or MTC. The results obtained suggest that while samples for Tg protein and Tg/CT mRNA measurements from CLN suspicious for metastatic thyroid cancer should be always collected, their measurements should be restricted to cases in which FNAB-C gives uninformative or inconsistent diagnosis with respect to patient’s biochemical and/or clinical parameters.

Methods

Patients

The case study included 35 cervical lymph nodes (CLN) with definitive diagnosis from 28 consecutive patients referred, from September 2004 to October 2012, to the outpatients’ clinic of Endocrinology and Thyroid Diseases of the Policlinico Umberto I general hospital of Rome (Italy). The study was approved by the ethical committee of the Policlinico Umberto I hospital in agreement to the declaration of Helsinki and all patients gave written informed consent. Patients, 7 males and 21 females with a median age of 39.5 yr (range 20-72 yr), with single or multiple suspicious CLN underwent fine-needle aspiration biopsy (FNAB) followed by cytological (FNAB-C) evaluation, Tgp measurement, and Tgm and CTm assessment in the fine needle washout. Among them, 9 patients previously underwent total thyroidectomy with histological diagnosis of papillary thyroid cancer (see Table 1). All patients with thyroid cancer underwent unilateral neck dissection. The histological diagnosis showed metastatic PTC in 21 patients, metastatic MTC in 2, metastatic ATC in 2 and metastasis from extrathyroidal cancers in the remaining 3 patients (1 non-Hodgkin lymphoma, 1 rhino-pharyngeal and 1 lung carcinoma). The enlarged lymph nodes from the latter 3 patients were evaluated since they all presented thyroid nodules with ultrasound features suspicious of malignancy (i.e. hypoechogenicity, presence of irregular margins and microcalcifications).

Table 1 Cytological, molecular and histological diagnoses of suspicious metastatic cervical lymph nodes (CLN) from thyroid cancer patients

Ultrasonography, fine-needle aspiration biopsy (FNAB) and fine-needle washout

Thyroid ultrasonography (US) was performed on the cervical area using the Aplio XV (Toshiba, Japan) system equipped with a linear transducer (PLT-805AT). The scanning was performed on patients’ neck hyperextended in supine position. US parameters suggestive of malignant lymph node infiltration included: rounded shape and long-to-short axis ratio inferior to 1.5; irregular echogenicity; presence of microcalcifications; irregular vascularity, i.e. peripheral or mixed (hilar and peripheral) vascularity. Following US, patients selected for the FNAB were instructed not to take aspirin or any other anticoagulant in the 5 days prior to biopsy. A 25 -gauge needle, attached to 20 ml plastic syringe, was used to aspirate nodes under US assistance. Two to three separate aspiration from each CLN were made. All aspirates were smeared directly on glass slides for cytological examination as described below. The needle was then washed with 1 ml of phosphate buffered saline (PBS) by multiple pumping actions and the suspension was centrifuged at 1200 rpm for 5 min. The supernatant was collected and frozen to -20°C until analyzed for Tg protein level (FNAB-Tgp), while the pellet was quickly frozen in liquid nitrogen and stored at -80°C.

Cytological and histological analysis

Following FNAB the needle’s material was expelled onto glass slides and smeared with a second slide to spread the material across the surface. The slides were then either air-dried or wet-fixed using the Bio-Fix (Bio-Optica, Milan, Italy). Air-dried slides were stained with a May Grunwald-Giemsa solution, while the wet-fixed slides were stained with the Papanicolaou solution. For the histological diagnosis, soon after lymphadenectomy the tissue was placed in 10% buffered formalin and paraffin embedded. Four μm thick sections were then prepared and stained with hematoxylin and eosin [29]. Both cytological and histological diagnoses were made by two expert pathologists and were concordant in all cases. Both pathologists were, at the time of their diagnoses, unaware of Tgp, Tgm and CTm results as well the molecular biologists were unaware, at the time of their diagnoses, of the patologists diagnoses.

Tg protein and Tg autoantibody measurements

Tgp levels in the FNAB washout were measured using the immunoluminometric assay (ILMA) Tg-PluS (B.R.A.H.M.S., Hennigsdorf, Germany). The analytical and functional sensitivity of the assay was, respectively, 0.02 ng/ml and 0.15 ng/ml. Tg values below the functional sensitivity were considered undetectable [30]. Samples were assayed in duplicate either non-diluted or following 1:10, 1:100 and 1:1000 dilutions in PBS. Results were expressed as ng/FNAB [19]. Even if FNAB-Tgp measurement has been reported to be non-affected by serum Tg autoantibodies [31], all FNAB washout samples were routinely assayed for Tg autoantibodies using the Anti-Tgn kit from B.R.A.H.M.S. with a functional sensitivity of 20 U/ml. In all samples Tg autoantibodies were undetectable (below 20 U/ml).

Extraction and analysis of RNA

The above mentioned pellets have been resuspended in 500 μl of Isol-RNA lysis reagent (Eppendorf, Milano, Italy) and total RNA extracted as previously described [32]. In particular, the precipitation of RNA has been maximized by adding 20 μg of molecular biology-grade glycogen to isopropanol. The RNA has been reverse-transcribed using anchored Oligo(dT)23 primers and M-MLV reverse transcriptase (Sigma Aldrich Co. St-Louis, MO). Negative controls have been performed in parallel for all samples omitting the reverse transcriptase in the RT reaction mix. PCR mix has been prepared with dNTPs 0.2 mM, 1.5 U of HotMaster Taq DNA Polymerase (Eppendorf, Milano, Italy), 5 μl of 10x Taq buffer containing Mg2+, specific Tg, CT and beta-2-microglobulin (B2M) primers 0.5 μM, 2-3 μl of cDNA, and molecular biology-grade water to 50 μl. In particular, the sequences of the above primers were as follows: Tg, forward CTCTGGAAAGATTCTGACATGG (exon 28-29), reverse CTCTGGAAAGATTCTGACATGG (exon 30-31) (amplicon 243 bp); CT, forward CCTTCCTGGCTCTCAGCATC (exon 2), reverse GAGTTTAGTTGGCATTCTGG (exon 4) (amplicon 407); B2M, forward CAGCAGAGAATGGAAAGTC (exon 2), reverse CATGCTGCTTACATGTCTCG (exon 3) (amplicon 269 bp). After 2 min of initial denaturation at 94°C, 40 cycles have been run as follows: 94°C for 20 sec, 56-60°C for 10 sec, 65°C for 50 sec. Positive controls, represented by normal human thyroid tissue for Tg mRNA and the MTC derived cell line TT for CT mRNA, have been included each time. The obtained amplicons have been visualized by agarose gel electrophoresis, and their specificities have been checked by automated DNA sequencing (Primm, Milano, Italy).

Statistical analysis

Sensitivity, specificity, diagnostic accuracy, positive and negative predictive value of each diagnostic test were calculated. Differences in sensitivity, specificity, negative and positive predictive values and accuracy among the different tests were evaluated by the Fisher exact test. Cohen’s k coefficient was used to estimate the agreement between various diagnostic tests. Statistical calculations were performed using Stata version 8.0 (College Station, Texas, Stata Corporation, 2003). The results were considered statistically significant when the two-tailed p value was <0.05.

Results

FNAB cytology (FNAB-C) versus histological diagnosis

As reported in Table 1, FNAB-C was inadequate in 3 (8.6%) out the 35 samples of CLN, 2 of which were from anaechoic (cystic) CLN and 1 from hypoechoic CLN. The FNAB-C diagnosis of the 32 CLN was correctly provided in 27 cases, with accuracy of 84.4%. In the remaining 5 cases FNAB-C diagnosis of metastatic PTC in 4 CLN was incorrect because the histology demonstrated 2 metastatic MTC (Table 1, CLN n. 19 and 20) and 2 metastatic ATC (Table 1, CLN n. 12 and 13), while the fifth CLN with a benign cytology turned out to be a metastatic PTC (Table 1, CLN n. 34) These 5 FNAB-C diagnoses were considered as false negative. The specificity, sensitivity, positive (PPV) and negative (NPV) predictive values and accuracy of FNAB-C are reported in Table 2.

Table 2 Diagnostic performance of different tests for diagnosis of suspicious metastatic cervical lymph nodes (CLN) from thyroid cancer patients (n = 35)

FNAB Tg protein (FNAB-Tgp) versus histological diagnosis

As reported in Figure 1 and Table 1, Tgp level in the fine-needle washout was measured in 32 out of the 35 CLN with definitive diagnosis. In order to limit false negative results considered unacceptable and in agreement with other studies, we decided to adopt a Tgp cut-off value of 1 ng/FNAB [16]. FNAB-Tgp provided correct diagnoses in 29 CLN (24 true positive and 5 true negative), false negative results (Tgp level <1 ng/FNAB) in 2 harboring metastatic ATC and false positive result in one with definitive diagnosis of lymphoma. Among the 23 CLN in which histology showed metastatic PTC, Tgp values ranged from 37.5 ng to 62908 ng (mean 8742 ng/FNAB; SD 15001 ng). In Table 2, specificity, sensitivity, PPV, NPV and accuracy of FNAB-Tgp are reported.

Figure 1
figure1

Thyroglobulin concentrations in fine-needle biopsies of 32 cervical lymph nodes with histological diagnosis. MTC, medullary thyroid cancer (n = 3); NTC, non-thyroidal cancers (n = 3); TC, epithelial thyroid cancer (n = 26); PTC, papillary thyroid cancer (n = 23); ATC, anaplastic thyroid cancer (n = 3).

FNAB Tg (FNAB-Tgm) and CT (FNAB-CTm) mRNA versus histological diagnosis

Tg and CT mRNA levels were measured in 32 out of the 35 CLN with definitive diagnosis. In 2 cases samples were judged inadequate because of the absence of β2-microglobulin mRNA. As shown in Tables 1 and 2, the analysis of Tg mRNA in the fine-needle washout of the 30 samples provided a correct diagnosis in 27 cases (21 true positive and 6 true negative CLN) and 3 false negative results, 1 with definitive diagnosis of metastatic ATC and 2 of metastatic PTC.

The CT mRNA analysis provided correct results in all 30 samples (3 true positive and 27 true negative).

Comparison of the different tests in the diagnosis of suspicious CLN

The comparison of the diagnostic parameters of FNAB-C, FNAB-Tgp and FNAB-Tgm, alone or in combination, was performed excluding from the case series 3 CLN harboring metastasis from MTC and 3 CLN affected by extrathyroidal cancers. Specificity, sensitivity, PPV, NPV and accuracy are reported in Table 3.

Table 3 Diagnostic performance of the different tests employed in the diagnosis of suspicious metastatic cervical lymph nodes (CLN) from thyroid cancer patients

As it may be noticed, the diagnostic performances were comparable and not significantly different among FNAB-Tgp, FNAB-Tgm and FNAB-C. In addition, the combined use of FNAB-Tgp + FNAB-Tgm or FNAB-C + FNAB-Tgp + FNAB-Tgm did not improve significantly the diagnostic value of FNAB-C alone (Table 3).

When the analysis was restricted to the 26 CLN harboring metastatic PTC FNAB-C and FNAB-Tgp showed, respectively, 95.7 and 100% accuracy and, in the 20 CLN in which both diagnoses were available, a 95% overall agreement between the 2 tests was observed (Table 3). On the other hand, FNAB-Tgm showed 90.5% accuracy and an overall agreement of 94.7% (Cohen’s k = 0.64, p < 0.01) with FNAB-C in the 19 CLN in which both diagnoses were attained.

Regarding the 3 CLN harboring metastatic ATC (Table 1, CLN number 10, 12 and 13), FNAB-C identified correctly one of them (CLN number 10) and gave the erroneous diagnosis of metastatic PTC in the remaining two (from the same patient). As expected, in these 3 CLN FNAB-Tgp levels were low, only one (Table 1, CLN number 13) being above the cut-off value. On the other hand, FNAB-Tgm was positive in two CLN (Table 1, CLN number 10 and 12) and negative in one.

FNAB-Tgp provided a correct diagnosis in all 3 CLN with uninformative cytology. Also FNAB-Tgm provided correct diagnosis in 2 of the 3 CLN with inadequate cytology, being inadequate as well as in the third case.

Discussion

Cytological evaluation of FNAB represents the gold standard technique for the diagnosis of CLN suspected to harbor metastatic disease from thyroid cancer as well as from other primary tumors. The technique accuracy, highly dependent on the experience and ability of the cytopathologist, has been reported to vary from 73% to 94% [17, 18, 22, 25]. Over the last years, following clinical evidence showing that FNAB-Tgp in fine-needle washout improves the accuracy of FNAB-C in the evaluation of CLN metastases of DTC, it has been recommended the routine association of FNAB-Tgp with FNAB-C in the preoperative diagnosis of suspicious CLN [6, 7, 1427, 33]. We here report our experience with 35 CLN for which a definitive diagnosis was available, including cases harboring metastases from PTC, MTC, ATC and other primary tumors.

The results showed that, on 32 CLN harboring metastases from papillary and anaplastic thyroid carcinomas, FNAB-C had 88.5% accuracy, that is within the range reported in other studies [17, 18, 22, 25]. When FNAB-Tgp and FNAB-Tgm were used singly they had a diagnostic performance comparable and not statistically different from that of FNAB-C. In addition, the combination of FNAB-Tgp and/or FNAB-Tgm with FNAB-C did not improve significantly the diagnostic value of FNAB-C. On the other hand, both FNAB-Tgp and FNAB-Tgm compared favorably with FNAB-C. As expected, a major disagreement among the three diagnostic tests was observed in the 3 CLN harboring metastasis from ATC (Table 2, CLN number 10, 12 and 13). It is worth to note that although ATC are undifferentiated cancers, i.e. devoid of thyroid specific gene expression, we consider the absence or the low level (below the cut-off value of 1 ng/FNAB) of Tgp or the absence of Tgm as false negative results. In fact, in one of the three metastatic CLN from ATC the detectable Tgp correctly diagnosed one of them (CLN number 13), and the detectable Tgm was diagnostic in the other two (CLN number 10 and 12).

A major diagnostic value of FNAB-Tgp and FNAB-Tgm was observed in cases of uninformative FNAB-C, given that in all 3 CLN characterized by inadequate cytology FNAB-Tgp provided the correct diagnosis. In these cases, FNAB-Tgm also provided the correct diagnosis in 2 of them, being inadequate in one. Other instances in which the combined use of FNAB-Tgp, FNAB-Tgm and FNAB-CTm is valuable include those cases in which FNAB-C diagnosis is not consistent with patient’s clinical and biochemical parameters. This was the case (Table 1, CLN number 19 and 20) of the patient harboring metastatic MTC and characterized by elevated level of serum calcitonin in which FNAB-C indicated metastatic PTC, while on the contrary both FNAB-Tgp and FNAB-Tgm were negative, and FNAB-CTm positive.

Conclusions

FNAB-C remains the gold standard technique for the diagnosis of suspicious CLN due to its ability to efficiently diagnose metastasis not only from thyroid cancers, but also from other primary tumors. If confirmed on larger case studies, the results of this study suggest that samples for Tg/CT mRNA and Tg protein measurements from CLN suspicious for metastatic thyroid cancer should be always collected (Figure 2), but their measurements should be restricted to cases in which FNAB-C give uninformative or inconsistent diagnosis with respect to patient’s biochemical and/or clinical parameters. Finally, it is also worth to mention that this approach may significantly reduce the costs of the management of patients with thyroid cancer whose incidence has been increasing over the last years, being actually the fifth most common cancer in women.

Figure 2
figure2

Flow-chart for diagnosis of suspicious metastatic cervical lymph nodes (CLN) from thyroid cancer patients. Following fine-needle aspiration biopsies (FNAB) samples for Tg protein and Tg/CT mRNA measurements should be collected but their analysis restricted to cases with uninformative or clinically unsound FNAB-C diagnosis. Tg, thyroglobulin; CT, calcitonin.

References

  1. 1.

    Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM: Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010, 127: 2893-2917. 10.1002/ijc.25516.

    CAS  Article  PubMed  Google Scholar 

  2. 2.

    Trimboli P, Ulisse S, Graziano FM, Marzullo A, Ruggieri M, Calvanese A, Piccirilli F, Cavaliere R, Fumarola A, D’Armiento M: Trend in thyroid carcinoma size, age at diagnosis and histology in a retrospective study of 500 cases diagnosed over 20 years. Thyroid. 2006, 16: 1151-1155. 10.1089/thy.2006.16.1151.

    CAS  Article  PubMed  Google Scholar 

  3. 3.

    Sherman SI: Thyroid carcinoma. Lancet. 2003, 36: 501-511.

    Article  Google Scholar 

  4. 4.

    Kloos RT, Eng C, Evans DB, Francis GL, Gagel RF, Gharib H, Moley JF, Pacini F, Ringel MD, Schlumberger M, Wells SA, American Thyroid Association Guidelines Task Force: Medullary thyroid cancer: management guidelines of the American Thyroid Association. Thyroid. 2009, 19: 565-612. 10.1089/thy.2008.0403.

    Article  PubMed  Google Scholar 

  5. 5.

    Cooper DS, Doherty GM, Haugen BR, Kloos RT, Lee SL, Mandel SJ, Mazzaferri EL, Mclver B, Pacini F, Schlumberger M, Sherman SI, Steward DL, Tuttle RM, American Thyroid Association (ATA) Guidelines Taskforce on Thyroid Nodules and Differentiated Thyroid Cancer: Revised American Thyroid Association management guidelines for patients with thyroid nodules and differentiated thyroid cancer. Thyroid. 2009, 19: 1167-1214. 10.1089/thy.2009.0110.

    Article  PubMed  Google Scholar 

  6. 6.

    Schlumberger M, Berg G, Cohen O, Duntas L, Jamar F, Jarzab B, Limbert E, Lind P, Pacini F, Reiners C, Sánchez Franco F, Toft A, Wiersinga WM: Follow-up of low-risk patients with differentiated thyroid carcinoma: a European perspective. Eur J Endocrinol. 2004, 150: 105-112. 10.1530/eje.0.1500105.

    CAS  Article  PubMed  Google Scholar 

  7. 7.

    Pacini F, Schlumberger M, Dralle H, Elisei R, Smit JW, Wiersinga W: European Thyroid Cancer Taskforce: European consensus for the management of patients with differentiated thyroid carcinoma of the follicular epithelium. Eur J Endocrinol. 2006, 154: 787-803. 10.1530/eje.1.02158.

    CAS  Article  PubMed  Google Scholar 

  8. 8.

    Cervin JR, Silverman JF, Loggie BW, Geisinger KR: Virchow’s node revisited. Analysis with clinicopathologic correlation of 152 fine-needle aspiration biopsies of supraclavicular lymph nodes. Arch Pathol Lab Med. 1995, 8: 727-730.

    Google Scholar 

  9. 9.

    Stack BC, Ferris RL, Goldenberg D, Haymart M, Shaha A, Sheth S, Sosa JA, Tufano RP: American Thyroid Association Surgical Affairs Committee: American thyroid association consensus review and statement regarding the anatomy, terminology, and rationale for lateral neck dissection in differentiated thyroid cancer. Thyroid. 2012, 22: 501-508. 10.1089/thy.2011.0312.

    Article  PubMed  Google Scholar 

  10. 10.

    Florentine BD, Staymates B, Rabadi M, Barstis J, Black A: Cancer Committee of the Henry Mayo Newhall Memorial Hospital: The reliability of fine-needle aspiration biopsy as the initial diagnostic procedure for palpable masses: a 4-year experience of 730 patients from a community hospital-based outpatient aspiration biopsy clinic. Cancer. 2006, 107: 406-416. 10.1002/cncr.21976.

    Article  PubMed  Google Scholar 

  11. 11.

    Cignarelli M, Triggiani V, Ciampolillo A, Ambrosi A, Giorgino F, Liso V, Giorgino R: High frequency of incidental diagnosis of extrathyroidal neoplastic diseases at the fine-needle aspiration biopsy of laterocervical lymph nodes in patients with thyroid nodules. Thyroid. 2001, 11: 65-71. 10.1089/10507250150500685.

    CAS  Article  PubMed  Google Scholar 

  12. 12.

    Ustün M, Risberg B, Davidson B, Berner A: Cystic change in metastatic lymph nodes: A common diagnostic pitfall in fine-needle aspiration cytology. Diagn Cytopathol. 2002, 27: 387-392. 10.1002/dc.10201.

    Article  PubMed  Google Scholar 

  13. 13.

    Kessler A, Rappaport Y, Blank A, Marmor S, Weiss J, Graif M: Cystic appearance of cervical lymph nodes is characteristic of metastatic papillary thyroid carcinoma. J Clin Ultrasound. 2003, 1: 21-25.

    Article  Google Scholar 

  14. 14.

    Cignarelli M, Ambrosi A, Marino A, Lamacchia O, Campo M, Picca G, Giorgino F: Diagnostic utility of thyroglobulin detection in fine-needle aspiration of cervical cystic metastatic lymph nodes from papillary thyroid cancer with negative cytology. Thyroid. 2003, 13: 1163-1167. 10.1089/10507250360731578.

    CAS  Article  PubMed  Google Scholar 

  15. 15.

    Borel AL, Boizel R, Faure P, Barbe G, Boutonnat J, Sturm N, Seigneurin D, Bricault I, Caravel JP, Chaffanjon P, Chabre O: Significance of low levels of thyroglobulin in fine needle aspirates from cervical lymph nodes of patients with a history of differentiated thyroid cancer. Eur J Endocrinol. 2008, 158: 691-698. 10.1530/EJE-07-0749.

    CAS  Article  PubMed  Google Scholar 

  16. 16.

    Snozek CL, Chambers EP, Reading CC, Sebo TJ, Sistrunk JW, Singh RJ, Grebe SK: Serum thyroglobulin, high-resolution ultrasound, and lymph node thyroglobulin in diagnosis of differentiated thyroid carcinoma nodal metastases. J Clin Endocrinol Metab. 2007, 92: 4278-4281. 10.1210/jc.2007-1075.

    CAS  Article  PubMed  Google Scholar 

  17. 17.

    Salmaslıoğlu A, Erbil Y, Cıtlak G, Ersöz F, Sarı S, Olmez A, Tunacı M, Yılmazbayhan D, Colak N, Ozarmağan S: Diagnostic value of thyroglobulin measurement in fine-needle aspiration biopsy for detecting metastatic lymph nodes in patients with papillary thyroid carcinoma. Langenbecks Arch Surg. 2011, 396: 77-81. 10.1007/s00423-010-0723-1.

    Article  PubMed  Google Scholar 

  18. 18.

    Kim MJ, Kim EK, Kim BM, Kwak JY, Lee EJ, Park CS, Cheong WY, Nam KH: Thyroglobulin measurement in fine-needle aspirate washout: the criteria for neck node dissection for patients with thyroid cancer. Clin Endocrinol. 2009, 70: 145-151. 10.1111/j.1365-2265.2008.03297.x.

    CAS  Article  Google Scholar 

  19. 19.

    Pacini F, Fugazzola L, Lippi F, Ceccarelli C, Centoni R, Miccoli P, Elisei R, Pinchera A: Detection of thyroglobulin in fine needle aspirates of nonthyroidal neck masses: a clue to the diagnosis of metastatic differentiated thyroid cancer. J Clin Endocrinol Metab. 1992, 74: 1401-1404. 10.1210/jc.74.6.1401.

    CAS  PubMed  Google Scholar 

  20. 20.

    Baskin HJ: Detection of recurrent papillary thyroid carcinoma by thyroglobulin assessment in the needle washout after fine-needle aspiration of suspicious lymph nodes. Thyroid. 2004, 14: 959-963. 10.1089/thy.2004.14.959.

    Article  PubMed  Google Scholar 

  21. 21.

    Cunha N, Rodrigues F, Curado F, Ilhéu O, Cruz C, Naidenov P, Rascão MJ, Ganho J, Gomes I, Pereira H, Real O, Figueiredo P, Campos B, Valido F: Thyroglobulin detection in fine-needle aspirates of cervical lymph node: a technique for the diagnosis of metastatic differentiated thyroid cancer. Eur J Endocrinol. 2007, 157: 101-107. 10.1530/EJE-07-0088.

    CAS  Article  PubMed  Google Scholar 

  22. 22.

    Bournaud C, Charrié A, Nozières C, Chikh K, Lapras V, Denier ML, Paulin C, Decaussin-Petrucci M, Peix JL, Lifante JC, Cornu C, Giraud C, Orgiazzi J, Borson-Chazot F: Thyroglobulin measurement in fine-needle aspirates of lymph nodes in patients with differentiated thyroid cancer: a simple definition of the threshold value, with emphasis on potential pitfalls of the method. Clin Chem Lab Med. 2010, 48: 1171-1177.

    CAS  Article  PubMed  Google Scholar 

  23. 23.

    Lee YH, Seo HS, Suh SI, Lee NJ, Kim JH, Seol HY, Lee JH, Kwon SY, Kim NH, Seo JA, Yang KS: Cut-off value for needle washout thyroglobulin in athyrotropic patients. Laryngoscope. 2010, 120: 1120-1124.

    PubMed  Google Scholar 

  24. 24.

    Frasoldati A, Toschi E, Zini M, Flora M, Caroggio A, Dotti C, Valcavi R: Role of thyroglobulin measurement in fine-needle aspiration biopsies of cervical lymph nodes in patients with differentiated thyroid cancer. Thyroid. 1999, 9: 105-111. 10.1089/thy.1999.9.105.

    CAS  Article  PubMed  Google Scholar 

  25. 25.

    Sohn YM, Kim MJ, Kim EK, Kwak JY: Diagnostic performance of thyroglobulin value in indeterminate range in fine needle aspiration washout fluid from lymph nodes of thyroid cancer. Yonsei Med J. 2012, 53: 126-131. 10.3349/ymj.2012.53.1.126.

    CAS  Article  PubMed  Google Scholar 

  26. 26.

    Giovanella L, Cerlani L, Suriano S, Crippa S: Thyroglobulin measurement on fine-needle washout fluids: influence of sample collection methods. Diagn Cytopathol. 2009, 37: 42-44. 10.1002/dc.20964.

    Article  PubMed  Google Scholar 

  27. 27.

    Kim DW, Jeon SJ, Kim CG: Usefulness of thyroglobulin measurement in needle-washout of fine-needle aspiration biopsy for the diagnosis of cervical lymph node metastases from papillary thyroid cancer before thyroidectomy. Endocrine. 2012, 42: 399-403. 10.1007/s12020-012-9636-9.

    CAS  Article  PubMed  Google Scholar 

  28. 28.

    Pomorski L, Kaczka K, Piaskowski S, Wójcik I, Rieske P, Matejkowska M, Kuzdak K: Detection of lymph node metastases of papillary thyroid cancer – comparison of the results of histopathology, immunohistochemistry and reverse transcription-polymerase chain reaction – a preliminary report. Langenbecks Arch Surg. 2005, 390: 209-215. 10.1007/s00423-004-0528-1.

    CAS  Article  PubMed  Google Scholar 

  29. 29.

    Basciani S, Watanabe M, Mariani S, Passeri M, Persichetti A, Fiore D, Scotto D'Abusco A, Caprio M, Lenzi A, Fabbri A, Gnessi L: Hypogonadism in a patient with two novel mutations of the luteinizing hormone beta-subunit gene expressed in a compound heterozygous form. J Clin Endocrinol Metab. 2012, 97: 3031-3038. 10.1210/jc.2012-1986.

    CAS  Article  PubMed  Google Scholar 

  30. 30.

    Morgenthaler NG, Froehlich J, Rendl J, Willnich M, Alonso C, Bergmann A, Reiners C: Techincal evaluation of a new immunoradiometric and a new immunoluminometric assay for thyroglobulin. Clin Chem. 2002, 48: 1077-1083.

    CAS  PubMed  Google Scholar 

  31. 31.

    Boi F, Baghino G, Atzeni F, Lai ML, Faa G, Mariotti S: The diagnostic value for differentiated thyroid carcinoma metastases of thyroglobulin (Tg) measurement in washout fluid from fine-needle aspiration biopsy of neck lymph node is maintained in presence of circulating anti-Tg antibodies. J Clin Endocrinol Metab. 2006, 91: 1364-1369. 10.1210/jc.2005-1705.

    CAS  Article  PubMed  Google Scholar 

  32. 32.

    Cianfarani F, Baldini E, Cavalli A, Marchioni E, Lembo L, Teson M, Persechino S, Zambruno G, Ulisse S, Odorisio T, D'Armiento M: TSH receptor and thyroid specific genes expression in human skin. J Invest Dermatol. 2010, 130: 93-101. 10.1038/jid.2009.180.

    CAS  Article  PubMed  Google Scholar 

  33. 33.

    Baldini E, Sorrenti S, Catania A, Guaitoli E, Prinzi N, Mocini R, Nardi F, D'Armiento E, Bianchini M, Favoriti P, Di Matteo FM, Ruggieri M, De Antoni E, Ulisse S: Diagnostic utility of thyroglobulin measurement in the fine needle aspirates from cervical lymph nodes: a case report. G Chir. 2012, 33: 387-391.

    CAS  PubMed  Google Scholar 

Pre-publication history

  1. The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6890/13/7/prepub

Download references

Acknowledgment

The authors are very grateful to Dr. Renzo Mocini for the English revision.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Salvatore Ulisse.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contribution

EB, SS, PM, EDeA and SU conceived the study. EB, CDG, AA, LG, GC and EDA run the experimental procedures and organized data collection. SU and CDV performed the statistical analysis. SS, PM, EDeA and SU drafted the manuscript. All authors read and approved the final manuscript.

Enke Baldini, Salvatore Sorrenti contributed equally to this work.

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.

Authors’ original file for figure 1

Authors’ original file for figure 2

Rights and permissions

Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and Permissions

About this article

Cite this article

Baldini, E., Sorrenti, S., Di Gioia, C. et al. Cervical lymph node metastases from thyroid cancer: does thyroglobulin and calcitonin measurement in fine needle aspirates improve the diagnostic value of cytology?. BMC Clin Pathol 13, 7 (2013). https://doi.org/10.1186/1472-6890-13-7

Download citation

Keywords

  • Thyroid cancer
  • Lymph node metastasis
  • Diagnosis
  • Thyroglobulin
  • Calcitonin
  • Fine-needle aspiration cytology
  • Follow-up